News

What's driving the shift to spatially resolved molecular analysis? The global in situ hybridization market, valued at USD ...
Researchers demonstrate orbital hybridization in graphene-based quantum dots, revealing how anisotropic confinement influences electronic states at the atomic scale.
Microwell hybridization assay - Amplicons were detected on microwell plates (Nunc Immobilizer Amino Surface, Nunc A/S, Roskilde, Denmark). The aminated probe (5'amine TTTTTTTTTTGCCCGTCCCGCCGATCTC3') ...
A novel, low-cost, and disposable thread-based electrofluidic analytical method employing isotachophoresis (ITP) was developed for demonstrating surface DNA hybridization. This approach was based on ...
A hybridization-based MLST assay using a set of capture probes corresponding to seven taxonomic markers from a variety of phytoplasmas was developed. Hybridization probes were designed targeting the ...
In this article, Roche discusses the increasing automation of science and next-generation sequencing (NGS) in particular and demonstrates an efficient DNA hybridization workflow.
In the present study, researchers estimated the efficiency of hybridization probe capture in enriching material related to the CoV genome in oral and rectal samples collected from bats.
New approaches are needed to quantify specific genes of interest in tens of thousands of single cells in a cost-effective and sensitive manner. We developed an approach called Hybridization of Probes ...