By leveraging the concept of chirality, or the difference of a shape from its mirror image, EPFL scientists have engineered ...

What's driving the shift to spatially resolved molecular analysis? The global in situ hybridization market, valued at USD 1.64 billion ...

What's driving the shift to spatially resolved molecular analysis? The global in situ hybridization market, valued at USD ...

Researchers demonstrate orbital hybridization in graphene-based quantum dots, revealing how anisotropic confinement influences electronic states at the atomic scale.

Microwell hybridization assay - Amplicons were detected on microwell plates (Nunc Immobilizer Amino Surface, Nunc A/S, Roskilde, Denmark). The aminated probe (5'amine TTTTTTTTTTGCCCGTCCCGCCGATCTC3') ...

A novel, low-cost, and disposable thread-based electrofluidic analytical method employing isotachophoresis (ITP) was developed for demonstrating surface DNA hybridization. This approach was based on ...

A hybridization-based MLST assay using a set of capture probes corresponding to seven taxonomic markers from a variety of phytoplasmas was developed. Hybridization probes were designed targeting the ...

In this article, Roche discusses the increasing automation of science and next-generation sequencing (NGS) in particular and demonstrates an efficient DNA hybridization workflow.